Skip to content
This repository was archived by the owner on Jan 22, 2024. It is now read-only.
This repository was archived by the owner on Jan 22, 2024. It is now read-only.

How to use the sequence alignment function? #899

Description

@Oliwans

Hello, I read the documentation carefully and found out that the documentation uses window.createAlignmentView to create a sequence alignment.

I use react to develop and use the tag to display the sequence. If I want to use the sequence Alignment function, I saw the demo and checked the source code, but I still don't know how to use it in react? Click the button in the picture below, where should the method triggered by it be written? The following is my code example, but it doesn’t work,I hope to use some fake data, just show it, and I will use other tools to generate real data, thank you!

image

import React from "react";
import { Editor, updateEditor, AlignmentView } from "open-vector-editor";
import store from "./store";

import "./App.css";

function App() {
  React.useEffect(() => {
    updateEditor(store, "DemoEditor", {
      sequenceData: {
        circular: true,
        sequence:
          "gtagagagagagtgagcccgacccccgtagagagagagtgagcccgacccccgtagagagagagtgagcccgacccccgtagagagagagtgagcccgaccccc",
        features: [
          {
            id: "2oi452",
            name: "I'm a feature :)",
            start: 10,
            end: 20
          }
        ],
panelsShown: [
        [
          {
            id: "circular",
            name: "Circular Map",
            active: true,
          },
          {
            id: "rail",
            name: "Linear Map",
            active: false,
          },
          {
            id: "jbeiAlignment1",
            type: "alignment", //panel must be of type alignment
            name: "Jbei Alignment p1243124",
            active: true
          }
        ],
        [
          {
            id: "sequence",
            name: "Sequence Map",
            active: true,
          },
          {
            id: "properties",
            name: "Properties",
            active: false,
          },
        ],
      ],
      }
    });
  });
  const editorProps = {
    editorName: "DemoEditor",
    isFullscreen: true,
    showMenuBar: true,
ToolBarProps: {
      toolList: global.viewRole
        ? [
            "cutsiteTool",
            "featureTool",
            "oligoTool",
            "orfTool",
            "partTool",
            "findTool",
            "visibilityTool",
          ]
        : [
            // "saveTool",
            "downloadTool",
            // "importTool",
            // "undoTool",
            // "redoTool",
            "cutsiteTool",
            "featureTool",
            "alignmentTool",
            "oligoTool",
            "orfTool",
            // "viewTool",
            "partTool",
            // "editTool",
            "findTool",
            "visibilityTool",
            // "propertiesTool",
          ],
    },
  };

  return (
    <div>
      <Editor {...editorProps} />
      <AlignmentView {...{
        id: "jbeiAlignment1", //give your alignment a unique id
        pairwiseAlignments: [  // this is an array of [referenceSequence, alignedSequence]
          [
            { //reference sequence must come first!
              sequenceData: {
                id: "FWER1231", //every sequenceData and alignmentData should have a unique id
                name: "GFPuv58",
                sequence:	"ttgagggg",
                features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}]
              },
              alignmentData: {
                sequence:	"ttgag--ggg--" //this length should be the same as the below alignmentData length!
              }
            },{ //aligned sequence must come second!
              sequenceData: {
                name: "GFPuv58",
                sequence:	"gagccgggtt"
              },
              alignmentData: {
                sequence:	"--gagccgggtt" //this length should be the same as the above alignmentData length!
              }
            }
          ]
        ],
        alignmentTracks: [
          { //reference sequence must come first!
            sequenceData: {
              id: "FWER1231", //every sequenceData and alignmentData should have a unique id
              name: "GFPuv58",
              sequence:	"ttgayyggggyy",
              features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}]
            },
            alignmentData: {
              sequence:	"ttgag--ggg--" //this length should be the same as the below alignmentData length!
            }
          }
        ],
        //additional view options:

        alignmentAnnotationVisibility: {
              features: true,
              translations: false,
              parts: true,
              orfs: true,
              orfTranslations: false,
              axis: true,
              cutsites: false,
              primers: true,
              reverseSequence: false,
              fivePrimeThreePrimeHints: true, 
              axisNumbers: true
          },
          alignmentAnnotationLabelVisibility: {
              features: true,
              parts: true,
              cutsites: false
          },
      }}/>
    </div>
  );
}

export default App;

Metadata

Metadata

Assignees

No one assigned

    Labels

    No labels
    No labels

    Type

    No type

    Projects

    No projects

    Milestone

    No milestone

    Relationships

    None yet

    Development

    No branches or pull requests

    Issue actions